Description
The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.
The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.
What’s in the box?
Item/ Catalog number selected: Q4461 | Part # | Size |
---|---|---|
pTargeT™ Sequencing Primer (24mer) | Q446A | 1 × 2μg |
SDS For Q4461
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.
Storage Conditions
