Loading...

pUC/M13 Sequencing Primers

pUC/M13 Sequencing Primers

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
  • Supplied at a concentration of 10ÎĽg/ml
  • pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
  • pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

Please Enquire

Description

Choose a primer length and direction by Catalog no

Forward 24mer
Size: 2µg
Catalog number: Q5601

Reverse 17mer
Size: 2µg
Catalog number: Q5401

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Reference

  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.

Specifications

What’s in the box?
Forward 24mer
Size: 2µg

Item Part # Size
pUC/M13 Primer, Forward (24mer) Q560A 1 Ă— 2ÎĽg

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

 

What’s in the box?
Reverse 17mer
Size: 2µg

Item Part # Size
pUC/M13 Primer, Reverse (17mer) Q540A 1 Ă— 2ÎĽg

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB