Description
Choose a primer length and direction by Catalog no
The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.
Primer Sequences
- Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
- Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´
Reference
- Messing, J. (1983) Meth. Enzymol. 101, 20–78.
What’s in the box?
Forward 24mer
Size: 2µg
| Item | Part # | Size |
|---|---|---|
| pUC/M13 Primer, Forward (24mer) | Q560A | 1 × 2μg |
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.
Storage Conditions
What’s in the box?
Reverse 17mer
Size: 2µg
| Item | Part # | Size |
|---|---|---|
| pUC/M13 Primer, Reverse (17mer) | Q540A | 1 × 2μg |
SDS
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.
Storage Conditions
