Description
Catalog number selected: A3600
Catalog number selected: A3610
Efficient T-Vector Cloning with Blue/White Selection
The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.
The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.
pGEM®-T Vector Map and Sequence
The pGEM®-T Vector is derived from the pGEM®-5Zf(+) Vector (GenBank® Accession No. X65308). The pGEM®-T Vector was created by linearizing the pGEM®-5Zf(+) Vector with EcoRV at base 51 and adding a T to both 3´-ends. The position of the T is indicated by * in the pGEM®-T Vector Sequence (.txt).
In the pGEM®-T Vector, T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the α-peptide coding region for β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be directly identified by Blue/White Screening on indicator plates. The vector allows preparation of single-stranded DNA due to its f1 Origin of Replication.
The multiple cloning site is flanked by recognition sites for the restriction enzyme BstZI, allowing release of the insert by a single-enzyme digestion. Alternatively, a double digestion may be used to release the insert from the vector.
The pGEM®-T Vector System II contains JM109 Competent Cells in addition to all of the pGEM®-T Vector System I components.
References
- Mezei, L.M. and Storts, D.R. (1994) In: PCR Technology: Current Innovations, Griffin, H.G. and Griffin, A.M., eds., CRC Press, Boca Raton, FL, 21.
- Robles, J. and Doers, M. (1994) Promega Notes 45, 19–20.
- Clark, J.M. (1988) Nucl. Acids Res. 16, 9677–86.
- Newton, C.R. and Graham, A. (1994) In: PCR, BIOS Scientific Publishers, Ltd., Oxford, UK, 13.
What’s in the box?
| Item/ Catalog number selected: A3600 | Part # | Size | Available Separately |
|---|---|---|---|
| pGEM®-T Vector | A362A | 1 × 1.2μg | |
| Control Insert DNA | A363A | 1 × 12μl | |
| 2X Rapid Ligation Buffer | C671A | 1 × 200μl | View Product |
| T4 DNA Ligase | M180A | 1 × 100u |
SDS For A3600
Download SDSUse Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures
Storage Conditions
What’s in the box?
| Item/ Catalog number selected: A3610 | Part # | Size | Available Separately |
|---|---|---|---|
| pGEM®-T Vector | A362A | 1 × 1.2μg | |
| Control Insert DNA | A363A | 1 × 12μl | |
| 2X Rapid Ligation Buffer | C671A | 1 × 200μl | View Product |
| JM109 Competent Cells, High Efficiency | L200A | 6 × 200μl | |
| T4 DNA Ligase | M180A | 1 × 100u |
SDS For A3610
Download SDSUse Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.
Storage Conditions
See Protocol for detailed storage recommendations.
