Loading...

pGEM®-T Vector Systems

pGEM®-T Vector Systems

Convenience for Cloning PCR Products

  • Insert excision with a BstZI single digest
  • Ligation can be completed in 1 hour at room temperature
  • Available with or without competent cells

Please Enquire

Description

Size

Efficient T-Vector Cloning with Blue/White Selection

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

pGEM®-T Vector Map and Sequence

 

The pGEM®-T Vector is derived from the pGEM®-5Zf(+) Vector (GenBank® Accession No. X65308). The pGEM®-T Vector was created by linearizing the pGEM®-5Zf(+) Vector with EcoRV at base 51 and adding a T to both 3´-ends. The position of the T is indicated by * in the pGEM®-T Vector Sequence (.txt).

In the pGEM®-T Vector, T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the α-peptide coding region for β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be directly identified by Blue/White Screening on indicator plates. The vector allows preparation of single-stranded DNA due to its f1 Origin of Replication.

The multiple cloning site is flanked by recognition sites for the restriction enzyme BstZI, allowing release of the insert by a single-enzyme digestion. Alternatively, a double digestion may be used to release the insert from the vector.

The pGEM®-T Vector System II contains JM109 Competent Cells in addition to all of the pGEM®-T Vector System I components.

References

  1. Mezei, L.M. and Storts, D.R. (1994) In: PCR Technology: Current Innovations, Griffin, H.G. and Griffin, A.M., eds., CRC Press, Boca Raton, FL, 21.
  2. Robles, J. and Doers, M. (1994) Promega Notes 45, 19–20.
  3. Clark, J.M. (1988) Nucl. Acids Res. 16, 9677–86.
  4. Newton, C.R. and Graham, A. (1994) In: PCR, BIOS Scientific Publishers, Ltd., Oxford, UK, 13.

Protocols

Complete Protocol

pGEM®-T and pGEM®-T Easy Vector Systems Technical Manual

Quick Protocols

pGEM T and pGEM T Easy Vector Systems FB033

Specifications

What’s in the box?

Item/ Catalog number selected: A3600 Part # Size Available Separately
pGEM®-T Vector A362A 1 × 1.2μg
Control Insert DNA A363A 1 × 12μl
2X Rapid Ligation Buffer C671A 1 × 200μl View Product
T4 DNA Ligase M180A 1 × 100u

SDS For A3600

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures

Storage Conditions

What’s in the box?

Item/ Catalog number selected: A3610 Part # Size Available Separately
pGEM®-T Vector A362A 1 × 1.2μg
Control Insert DNA A363A 1 × 12μl
2X Rapid Ligation Buffer C671A 1 × 200μl View Product
JM109 Competent Cells, High Efficiency L200A 6 × 200μl
T4 DNA Ligase M180A 1 × 100u

SDS For  A3610

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

See Protocol for detailed storage recommendations.