Molecular Products Co.

Search
customer-support

Call Us Now:

0334-7752577

pTargeT™ Sequencing Primer

Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector

  • Hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector

Please Enquire

Description

[ts-heading h2=”Size” css_animation=”fadeInUp”][/ts-heading]

Catalog number selected: Q4461

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

[ts-heading h2=”Specifications” txt_align=”center” css_animation=”fadeInUp”][/ts-heading]

What’s in the box?

[wpdatatable id=65 table_view=regular]

SDS For Q4461

[easy_media_download url=”https://gomolecular.pk/wp-content/uploads/2021/06/Q4461.zip” text=”Download SDS” color=”blue_three” ]

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions