Molecular Products Co.

Search
customer-support

Call Us Now:

0334-7752577

pGEM®-T Vector Systems

Convenience for Cloning PCR Products

  • Insert excision with a BstZI single digest
  • Ligation can be completed in 1 hour at room temperature
  • Available with or without competent cells

Please Enquire

Description

[ts-heading h2=”Size” css_animation=”fadeInUp”][/ts-heading][ts-custom-heading text=”Efficient T-Vector Cloning with Blue/White Selection ” font_container=”tag:h1|text_align:center” css_animation=”fadeIn”]

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

[ts-custom-heading text=”pGEM®-T Vector Map and Sequence” font_container=”tag:h1|text_align:center” css_animation=”fadeIn”]

 

The pGEM®-T Vector is derived from the pGEM®-5Zf(+) Vector (GenBank® Accession No. X65308). The pGEM®-T Vector was created by linearizing the pGEM®-5Zf(+) Vector with EcoRV at base 51 and adding a T to both 3´-ends. The position of the T is indicated by * in the pGEM®-T Vector Sequence (.txt).

In the pGEM®-T Vector, T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the α-peptide coding region for β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be directly identified by Blue/White Screening on indicator plates. The vector allows preparation of single-stranded DNA due to its f1 Origin of Replication.

The multiple cloning site is flanked by recognition sites for the restriction enzyme BstZI, allowing release of the insert by a single-enzyme digestion. Alternatively, a double digestion may be used to release the insert from the vector.

The pGEM®-T Vector System II contains JM109 Competent Cells in addition to all of the pGEM®-T Vector System I components.

References

  1. Mezei, L.M. and Storts, D.R. (1994) In: PCR Technology: Current Innovations, Griffin, H.G. and Griffin, A.M., eds., CRC Press, Boca Raton, FL, 21.
  2. Robles, J. and Doers, M. (1994) Promega Notes 45, 19–20.
  3. Clark, J.M. (1988) Nucl. Acids Res. 16, 9677–86.
  4. Newton, C.R. and Graham, A. (1994) In: PCR, BIOS Scientific Publishers, Ltd., Oxford, UK, 13.

Protocols

Complete Protocol

pGEM®-T and pGEM®-T Easy Vector Systems Technical Manual

[easy_media_download url=”https://gomolecular.pk/wp-content/uploads/2021/06/pGEM-T-and-pGEM-T-Easy-Vector-Systems-TM042.zip” text=”Download” color=”blue_three” ] 

Quick Protocols

pGEM T and pGEM T Easy Vector Systems FB033

[easy_media_download url=”https://gomolecular.pk/wp-content/uploads/2021/06/pGEM-T-and-pGEM-T-Easy-Vector-Systems-FB033.zip” text=”Download” color=”blue_three” ]

[ts-heading h2=”Specifications” txt_align=”center” css_animation=”fadeInUp”][/ts-heading]

What’s in the box?

[wpdatatable id=66 table_view=regular]

SDS For A3600

[easy_media_download url=”https://gomolecular.pk/wp-content/uploads/2021/06/A3600.zip” text=”Download SDS” color=”blue_three” ]

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures

Storage Conditions

What’s in the box?

[wpdatatable id=67 table_view=regular]

SDS For  A3610

[easy_media_download url=”https://gomolecular.pk/wp-content/uploads/2021/06/A3610.zip” text=”Download SDS” color=”blue_three” ]

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

See Protocol for detailed storage recommendations.